Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK02043 |
---|---|
Accession No | AB046839 |
Description | sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G, transcript variant 1 |
Clone name | fj14720 |
Vector information | |
cDNA sequence | DNA sequence (4094 bp) Predicted protein sequence (869 aa) |
HaloTag ORF Clone |
FHC02043
|
Flexi ORF Clone | FXC02043 |
Source | Human fetal brain |
Rouge ID |
mKIAA1619
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1484 bp |
---|---|
Genome contig ID | gi89161187f_102622582 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (112782 - 112831) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 102722582 | 102735362 | 14 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 82 | 515 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 533 | 589 | PF01437 | Plexin | |
HMMSmart | IPR001627 | 82 | 515 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 533 | 589 | SM00423 | Plexin/semaphorin/integrin | |
IPR003599 | 600 | 682 | SM00409 | Immunoglobulin subtype | |
ProfileScan | IPR001627 | 61 | 531 | PS51004 | Semaphorin/CD100 antigen |
IPR007110 | 598 | 680 | PS50835 | Immunoglobulin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 5 | PPPQPVTLAPFGGLVSLGLP | 24 | SECONDARY | 20 | 2 | 28 | WGRLWPLLLSILTATAVPGPSL | 49 | SECONDARY | 22 | 3 | 707 | LYVLAIAALGGLCLILASSLLYV | 729 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GTAGCTGAGAACGTGGAATCC |
---|---|
Primer_r | TGGTTGTAAGTGGGGGCATTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |