Order Kazusa clone(s) from : ![]() |
Product ID | ORK05568 |
---|---|
Accession No | AB058745 |
Description | kelch repeat and BTB (POZ) domain containing 8 |
Clone name | fj22905s1 |
Vector information | |
cDNA sequence | DNA sequence (4403 bp) Predicted protein sequence (526 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1842
by Kazusa Mouse cDNA Project
|
Note | We replaced fj22905, former representative clones for KIAA1842 with fj22905s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2821 bp |
---|---|
Genome contig ID | gi89161205f_67036307 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (108015 - 108064) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 67136306 | 67144320 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 1 | 72 | PF00651 | BTB/POZ |
IPR011705 | 77 | 179 | PF07707 | BTB/Kelch-associated | |
IPR006652 | 256 | 302 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 304 | 353 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 395 | 441 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR006652 | 261 | 315 | SM00612 | Kelch repeat type 1 |
IPR006652 | 316 | 366 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 407 | 457 | SM00612 | Kelch repeat type 1 | |
ProfileScan | IPR000210 | 1 | 42 | PS50097 | BTB/POZ-like |
![]() |
Primer_f | TGGTCTGAGCCTATGCCTATC |
---|---|
Primer_r | TGGAAGAGAAGGTTGGGCTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |