Order Kazusa clone(s) from : ![]() |
Product ID | ORK01955 |
---|---|
Accession No | D31883 |
Description | actin binding LIM protein 1, transcript variant 2 |
Clone name | ha00949s1 |
Vector information | |
cDNA sequence | DNA sequence (7405 bp) Predicted protein sequence (724 aa) |
HaloTag ORF Clone |
FHC01955
![]() |
Flexi ORF Clone | FXC01955 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0059
by Kazusa Mouse cDNA Project
|
Note | We replaced ha00949, former representative clones for KIAA0059 with ha00949s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5144 bp |
---|---|
Genome contig ID | gi89161187r_116080862 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 116180862 | 116434206 | 22 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001781 | 43 | 99 | PD000094 | Zinc finger |
IPR001781 | 102 | 155 | PD000094 | Zinc finger | |
IPR001781 | 172 | 226 | PD000094 | Zinc finger | |
IPR001781 | 230 | 268 | PD000094 | Zinc finger | |
HMMPfam | IPR001781 | 45 | 101 | PF00412 | Zinc finger |
IPR001781 | 104 | 160 | PF00412 | Zinc finger | |
IPR001781 | 172 | 228 | PF00412 | Zinc finger | |
IPR001781 | 231 | 287 | PF00412 | Zinc finger | |
IPR003128 | 689 | 724 | PF02209 | Villin headpiece | |
HMMSmart | IPR001781 | 44 | 95 | SM00132 | Zinc finger |
IPR001781 | 103 | 155 | SM00132 | Zinc finger | |
IPR001781 | 171 | 222 | SM00132 | Zinc finger | |
IPR001781 | 230 | 282 | SM00132 | Zinc finger | |
IPR003128 | 689 | 724 | SM00153 | Villin headpiece | |
ProfileScan | IPR001781 | 43 | 102 | PS50023 | Zinc finger |
IPR001781 | 103 | 162 | PS50023 | Zinc finger | |
IPR001781 | 170 | 229 | PS50023 | Zinc finger | |
IPR001781 | 230 | 289 | PS50023 | Zinc finger | |
IPR003128 | 656 | 724 | PS51089 | Villin headpiece | |
ScanRegExp | IPR001781 | 45 | 78 | PS00478 | Zinc finger |
IPR001781 | 104 | 137 | PS00478 | Zinc finger | |
IPR001781 | 172 | 206 | PS00478 | Zinc finger | |
IPR001781 | 231 | 264 | PS00478 | Zinc finger |
Panel name | Genebridge 4 |
---|---|
Primer_f | TGGTTTGGGGTTAGTTATGAA |
Primer_r | CCGAGTTAGAGTTGATTGATA |
PCR product length | 281 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |