KIAA1424

Product ID	ORK04154
Accession No	AB037845
Description	Rho GTPase activating protein 21
Clone name	ha06448
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6631 bp) Predicted protein sequence (1944 aa)
Source	Human adult brain
Rouge ID	mKIAA1424 by Kazusa Mouse cDNA Project
Note	We replaced hh15972, former representative clones for KIAA1424 with ha06448. (2002/5/10)

Length: 6631 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	794 bp
Genome contig ID	gi89161187r_24812551
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCAATTAAACACTGGAAATAAAAATTGTTTTGGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTGCATGGCTTGAAACTTATTCTGATATATTTTTAGATGTCATCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	24912551	25050794	25	99.6	Perfect prediction
Ensembl gnome browser	6	r	80829934	80836598	2	97.0	Perfect prediction

Length: 1944 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5T5U3	100.0	Rho GTPase-acti...	Homo sapiens
NP_065875	100.0	Rho GTPase acti...	Homo sapiens
AAM22955	99.7	Rho-GTPase acti...	Homo sapiens
EAW86122	99.7	Rho GTPase acti...	Homo sapiens
XP_507699	99.5	Rho GTPase acti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040934	2.7e-41	48.6	KIAA1501
AB037725	1.1e-09	22.9	KIAA1304
AB007871	1.4e-08	30.6	KIAA0411
AB051509	1.4e-08	28.0	KIAA1722
AB014572	4.1e-08	29.2	KIAA0672

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	36	142	PF00595	PDZ/DHR/GLGF
	IPR001849	918	1026	PF00169	Pleckstrin-like
	IPR000198	1148	1301	PF00620	RhoGAP
HMMSmart	IPR001478	44	145	SM00228	PDZ/DHR/GLGF
	IPR001849	918	1028	SM00233	Pleckstrin-like
	IPR000198	1145	1322	SM00324	RhoGAP
ProfileScan	IPR001478	36	145	PS50106	PDZ/DHR/GLGF
	IPR001849	917	1026	PS50003	Pleckstrin-like
	IPR000198	1133	1325	PS50238	RhoGAP

Primer_f	ACAGTTGGTTTTTAGGGTGCC
Primer_r	ACCTGGAATGACTAAAGAATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACAGTTGGTTTTTAGGGTGCC
Primer_r	ACCTGGAATGACTAAAGAATG
PCR product length	150 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles