Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04547 |
---|---|
Accession No | AB007913 |
Description | chromodomain helicase DNA binding protein 5 |
Clone name | hg00035 |
Vector information | |
cDNA sequence | DNA sequence (6618 bp) Predicted protein sequence (978 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0444
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000330 | 5 | 23 | PF00176 | SNF2-related |
IPR001650 | 83 | 162 | PF00271 | DNA/RNA helicase | |
IPR009463 | 319 | 383 | PF06465 | Protein of unknown function DUF1087 | |
IPR009462 | 396 | 555 | PF06461 | Protein of unknown function DUF1086 | |
IPR012957 | 754 | 927 | PF08074 | CHD | |
HMMSmart | IPR001650 | 78 | 162 | SM00490 | DNA/RNA helicase |
ProfileScan | IPR001650 | 52 | 217 | PS51194 | DNA/RNA helicase |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGTAAAGGTGATTGTGTTGGC |
Primer_r | TGTGTGTGTGTCCTGAACTCC |
PCR product length | 352 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |