Gene/Protein Characteristic Table for KIAA0444
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04547
Accession No AB007913
Description chromodomain helicase DNA binding protein 5
Clone name hg00035
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6618 bp)
Predicted protein sequence (978 aa)
Source Human adult brain
Rouge ID mKIAA0444 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6618 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 978 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAB55959 0 100.0 hypothetical pr...
Homo sapiens
Q8TDI0 0 99.9 Chromodomain-he...
Homo sapiens
XP_525165 0 99.8 chromodomain he...
Pan troglodytes
XP_609360 0 96.9 similar to chro...
Bos taurus
XP_001492263 0 96.6 chromodomain he...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046784 3.1e-21 48.2 KIAA1564
AB002306 5.6e-21 47.3 KIAA0308
AB037837 6.2e-21 34.0 KIAA1416
AB037756 1.3e-20 30.4 KIAA1335
AB002307 1.6e-15 33.6 KIAA0309
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000330 5 23 PF00176 SNF2-related
IPR001650 83 162 PF00271 DNA/RNA helicase
IPR009463 319 383 PF06465 Protein of unknown function DUF1087
IPR009462 396 555 PF06461 Protein of unknown function DUF1086
IPR012957 754 927 PF08074 CHD
HMMSmart IPR001650 78 162 SM00490 DNA/RNA helicase
ProfileScan IPR001650 52 217 PS51194 DNA/RNA helicase
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f AGTAAAGGTGATTGTGTTGGC
Primer_r TGTGTGTGTGTCCTGAACTCC
PCR product length 352 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp