KIAA0704

Product ID	ORK01603
Accession No	AB014604
Description	oxysterol binding protein-like 3, transcript variant 1
Clone name	hg02921s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6137 bp) Predicted protein sequence (919 aa)
HaloTag ORF Clone	FHC01603
Flexi ORF Clone	FXC01603
Source	Human adult brain
Rouge ID	mKIAA0704 by Kazusa Mouse cDNA Project
Note	We replaced hg02921, former representative clones for KIAA0704 with hg02921s2. (2002/12/27)

Length: 6137 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3060 bp
Genome contig ID	gi89161213r_24703267
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGCCTAAAAAGTAATAAAGTTTTTATTTGGCTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAACCTTGATGTAGCCCCTACTACATACACTACAAGTTATGCCTTCTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	24803267	24986293	23	99.5	Perfect prediction

Length: 919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H4L5	100.0	Oxysterol-bindi...	Homo sapiens
XP_001160186	100.0	oxysterol-bindi...	Pan troglodytes
XP_001160094	96.5	oxysterol-bindi...	Pan troglodytes
XP_539480	94.2	similar to oxys...	Canis lupus fam...
XP_001916289	94.4	oxysterol bindi...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018315	4.2e-35	38.4	KIAA0772
AB051451	3.1e-33	33.5	KIAA1664
AB040967	2e-14	26.8	KIAA1534
AB040884	4e-12	23.7	KIAA1451

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	84	178	PF00169	Pleckstrin-like
HMMPfam	IPR000648	520	907	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	84	180	SM00233	Pleckstrin-like
ProfileScan	IPR001849	83	178	PS50003	Pleckstrin-like
ScanRegExp	IPR000648	659	670	PS01013	Oxysterol-binding protein

Primer_f	CTGTTTGGGCATCCTGGGTAC
Primer_r	TGTAGCAGGAGAGCCAGTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTGTTTGGGCATCCTGGGTAC
Primer_r	TGTAGCAGGAGAGCCAGTCAC
PCR product length	204 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles