KIAA0941

Product ID	ORK00692
Accession No	AB023158
Description	RAB11 family interacting protein 2 (class I)
Clone name	hh04956
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6059 bp) Predicted protein sequence (533 aa)
HaloTag ORF Clone	FHC00692
Flexi ORF Clone	FXC00692
Source	Human adult brain

Length: 6059 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4080 bp
Genome contig ID	gi89161187r_119654419
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TTATTGACTTATAGTTGATTAAAGTGTTTAAACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCAGTTGTCAACATTTATTACAGATACAGCGGTGTTACCATAATGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	119754419	119796104	5	99.2	Perfect prediction

Length: 533 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7L804	3.5e-206	100.0	Rab11 family-in...	Homo sapiens
XP_001152274	1.3e-205	99.6	RAB11 family in...	Pan troglodytes
XP_535026	9.5e-198	94.4	similar to Rab1...	Canis lupus fam...
XP_001494294	5.5e-197	94.5	similar to Rab1...	Equus caballus
EDL94565	2.2e-195	93.4	RAB11 family in...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020664	7.4e-18	30.9	KIAA0857
AB011110	0.00033	27.5	KIAA0538

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	51	63	PR00360	C2 calcium-dependent membrane targeting
FPrintScan	IPR000008	75	88	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	36	123	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	35	138	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	36	123	PS50004	C2 calcium-dependent membrane targeting

Primer_f	GTCTTGTAGGTGGTAGGTGTC
Primer_r	AGCAGCACTGTGATCCTTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTCTTGTAGGTGGTAGGTGTC
Primer_r	AGCAGCACTGTGATCCTTTCC
PCR product length	105 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles