KIAA1055

Product ID	ORK03292
Accession No	AB028978
Description	TBC1 domain family, member 2B
Clone name	hh09512
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5876 bp) Predicted protein sequence (868 aa)
HaloTag ORF Clone	FHC03292
Flexi ORF Clone	FXC03292
Source	Human adult brain
Rouge ID	mKIAA1055 by Kazusa Mouse cDNA Project

Length: 5876 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3268 bp
Genome contig ID	gi51511731r_75974383
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ACTAAAGGAAGAAATAAACTACTAATTTGTATAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGCATTGAAATTCAGTTATAGTCACTGGTGATGGGGCTCACCCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	76074383	76156912	13	99.4	Perfect prediction

Length: 868 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_055894	100.0	TBC1 domain fam...	Homo sapiens
Q9UPU7	100.0	TBC1 domain fam...	Homo sapiens
XP_510522	99.8	TBC1 domain fam...	Pan troglodytes
XP_001106607	97.8	similar to TBC1...	Macaca mulatta
EAW99190	100.0	TBC1 domain fam...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020689	1.5e-15	34.0	KIAA0882
AB014576	5.3e-14	32.5	KIAA0676
AB029031	2.1e-10	25.8	KIAA1108
AB011175	2.1e-09	21.4	KIAA0603
D13644	5.8e-09	24.1	KIAA0019

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	613	832	PF00566	RabGAP/TBC
HMMSmart	IPR000195	613	833	SM00164	RabGAP/TBC
ProfileScan	IPR001849	1	93	PS50003	Pleckstrin-like
ProfileScan	IPR000195	616	810	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	777	DYTLITFNWFLVVFVDSVVSDIL	799	PRIMARY	23

Primer_f	AATGTTTCACTGGGTAGACGG
Primer_r	ACACTTGATTCGAGCAGACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-