KIAA1829

Product ID	ORK07488
Accession No	AB058732
Description	zinc finger protein 527
Clone name	hj00069
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4863 bp) Predicted protein sequence (557 aa)
Source	Human adult brain

Length: 4863 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3189 bp
Genome contig ID	gi42406306f_42463015
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTGTATTTTATTTAAATTTTTTGTATTAAGTGCC
Flanking genome sequence (112795 - 112844)	----+--------+--------+--------+--------+----* TACTGTGTGCCAGGCTTTGTTCTAATCTAAGCAATGGAGATACAGCAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	42563015	42575808	2	99.0	Perfect prediction

Length: 557 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW56727	0	100.0	hCG1775038 [Hom...	Homo sapiens
BAG62727	0	99.6	unnamed protein...	Homo sapiens
Q8NB42	0	100.0	Zinc finger pro...	Homo sapiens
XP_001494212	0	89.6	zinc finger pro...	Equus caballus
AAI23538	1.1e-214	86.3	Zinc finger pro...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046831	5.4e-74	43.3	KIAA1611
AB058755	1.4e-71	40.3	KIAA1852
AB037770	2.7e-71	45.1	KIAA1349
AB075827	1.4e-69	54.3	KIAA1947
D31763	6.8e-69	45.5	KIAA0065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	250	272	PD000003	Zinc finger
	IPR007087	278	301	PD000003	Zinc finger
	IPR007087	306	329	PD000003	Zinc finger
	IPR007087	334	357	PD000003	Zinc finger
	IPR007087	362	385	PD000003	Zinc finger
	IPR007087	390	413	PD000003	Zinc finger
	IPR007087	418	441	PD000003	Zinc finger
	IPR007087	474	497	PD000003	Zinc finger
	IPR007087	502	524	PD000003	Zinc finger
	IPR007087	530	552	PD000003	Zinc finger
HMMPfam	IPR007087	250	272	PF00096	Zinc finger
	IPR007087	278	300	PF00096	Zinc finger
	IPR007087	306	328	PF00096	Zinc finger
	IPR007087	334	356	PF00096	Zinc finger
	IPR007087	362	384	PF00096	Zinc finger
	IPR007087	390	412	PF00096	Zinc finger
	IPR007087	418	440	PF00096	Zinc finger
	IPR007087	446	468	PF00096	Zinc finger
	IPR007087	474	496	PF00096	Zinc finger
	IPR007087	502	524	PF00096	Zinc finger
	IPR007087	530	552	PF00096	Zinc finger
HMMSmart	IPR015880	250	272	SM00355	Zinc finger
	IPR015880	278	300	SM00355	Zinc finger
	IPR015880	306	328	SM00355	Zinc finger
	IPR015880	334	356	SM00355	Zinc finger
	IPR015880	362	384	SM00355	Zinc finger
	IPR015880	390	412	SM00355	Zinc finger
	IPR015880	418	440	SM00355	Zinc finger
	IPR015880	446	468	SM00355	Zinc finger
	IPR015880	474	496	SM00355	Zinc finger
	IPR015880	502	524	SM00355	Zinc finger
	IPR015880	530	552	SM00355	Zinc finger
ProfileScan	IPR001909	1	33	PS50805	KRAB box
	IPR007087	222	249	PS50157	Zinc finger
	IPR007087	250	277	PS50157	Zinc finger
	IPR007087	278	305	PS50157	Zinc finger
	IPR007087	306	333	PS50157	Zinc finger
	IPR007087	334	361	PS50157	Zinc finger
	IPR007087	362	389	PS50157	Zinc finger
	IPR007087	390	417	PS50157	Zinc finger
	IPR007087	418	445	PS50157	Zinc finger
	IPR007087	446	473	PS50157	Zinc finger
	IPR007087	474	501	PS50157	Zinc finger
	IPR007087	502	529	PS50157	Zinc finger
	IPR007087	530	557	PS50157	Zinc finger
ScanRegExp	IPR007087	252	272	PS00028	Zinc finger
	IPR007087	280	300	PS00028	Zinc finger
	IPR007087	308	328	PS00028	Zinc finger
	IPR007087	336	356	PS00028	Zinc finger
	IPR007087	364	384	PS00028	Zinc finger
	IPR007087	392	412	PS00028	Zinc finger
	IPR007087	420	440	PS00028	Zinc finger
	IPR007087	448	468	PS00028	Zinc finger
	IPR007087	476	496	PS00028	Zinc finger
	IPR007087	504	524	PS00028	Zinc finger
	IPR007087	532	552	PS00028	Zinc finger

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-