Order Kazusa clone(s) from : ![]() |
Product ID | ORK01149 |
---|---|
Accession No | AB029034 |
Description | PHD finger protein 8, transcript variant 1 |
Clone name | hj04651s1 |
Vector information | |
cDNA sequence | DNA sequence (4695 bp) Predicted protein sequence (1084 aa) |
HaloTag ORF Clone |
FHC01149
![]() |
Flexi ORF Clone | FXC01149 |
Source | Human adult brain |
Rouge ID |
mKIAA1111
by Kazusa Mouse cDNA Project
|
Note | We replaced hj04651, former representative clones for KIAA1111 with hj04651s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1439 bp |
---|---|
Genome contig ID | gi89161218r_53880877 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 67 | 116 | PF00628 | Zinc finger |
IPR013129 | 294 | 394 | PF02373 | Transcription factor jumonji | |
HMMSmart | IPR001965 | 67 | 114 | SM00249 | Zinc finger |
IPR003347 | 255 | 411 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
ProfileScan | IPR001965 | 65 | 116 | PS50016 | Zinc finger |
IPR003347 | 255 | 411 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
ScanRegExp | IPR013032 | 68 | 83 | PS01186 | EGF-like region |
IPR001965 | 68 | 113 | PS01359 | Zinc finger |
![]() |
Primer_f | TTCCCCTGTCCTTCCTTCGTG |
---|---|
Primer_r | GGGTAGTGCCAAATGGAGGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCCCCTGTCCTTCCTTCGTG |
Primer_r | GGGTAGTGCCAAATGGAGGTG |
PCR product length | 126 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |