Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01149 |
---|---|
Accession No | AB029034 |
Description | PHD finger protein 8, transcript variant 1 |
Clone name | hj04651s1 |
Vector information | |
cDNA sequence | DNA sequence (4695 bp) Predicted protein sequence (1084 aa) |
HaloTag ORF Clone |
FHC01149
|
Flexi ORF Clone | FXC01149 |
Source | Human adult brain |
Rouge ID |
mKIAA1111
by Kazusa Mouse cDNA Project
|
Note | We replaced hj04651, former representative clones for KIAA1111 with hj04651s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1439 bp |
---|---|
Genome contig ID | gi89161218r_53880877 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 67 | 116 | PF00628 | Zinc finger |
IPR013129 | 294 | 394 | PF02373 | Transcription factor jumonji | |
HMMSmart | IPR001965 | 67 | 114 | SM00249 | Zinc finger |
IPR003347 | 255 | 411 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
ProfileScan | IPR001965 | 65 | 116 | PS50016 | Zinc finger |
IPR003347 | 255 | 411 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
ScanRegExp | IPR013032 | 68 | 83 | PS01186 | EGF-like region |
IPR001965 | 68 | 113 | PS01359 | Zinc finger |
RT-PCR-ELISA |
Primer_f | TTCCCCTGTCCTTCCTTCGTG |
---|---|
Primer_r | GGGTAGTGCCAAATGGAGGTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCCCCTGTCCTTCCTTCGTG |
Primer_r | GGGTAGTGCCAAATGGAGGTG |
PCR product length | 126 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |