KIAA0651

Product ID	ORK01109
Accession No	AB014551
Description	Rho/Rac guanine nucleotide exchange factor (GEF) 2
Clone name	sj09778
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4434 bp) Predicted protein sequence (1114 aa)
HaloTag ORF Clone	FHC01109
Flexi ORF Clone	FXC01109
Source
Rouge ID	mKIAA0651 by Kazusa Mouse cDNA Project
Note	We replaced hk01046, former representative clones for KIAA0651 with sj09778. (1999/12/25)

Length: 4434 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1087 bp
Genome contig ID	gi89161185r_154083270
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- AAAAAATTCAGGGAAAATTAAAAACCTGGAACTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATAAGGTACTGTCTTCCATAATGTCTGCCAATTCTGAGGAGGATGGTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	154183270	154226488	26	99.9	Perfect prediction

Length: 1114 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11223	100.0	Rho/Rac guanine...	synthetic construct
EAW53012	100.0	rho/rac guanine...	Homo sapiens
AAL96658	99.9	guanine nucleot...	Homo sapiens
EAW53018	99.7	rho/rac guanine...	Homo sapiens
EAW53016	99.7	rho/rac guanine...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011093	6.9e-59	37.2	KIAA0521
AB002378	1.2e-18	24.9	KIAA0380
AB002380	6.8e-18	25.5	KIAA0382
AB018263	3.1e-05	22.5	KIAA0720
AB033082	0.00054	26.3	KIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	169	219	PF00130	Protein kinase C
	IPR000219	367	559	PF00621	DH
	IPR001849	601	699	PF00169	Pleckstrin-like
HMMSmart	IPR002219	169	215	SM00109	Protein kinase C
	IPR000219	367	559	SM00325	DH
	IPR001849	601	701	SM00233	Pleckstrin-like
ProfileScan	IPR002219	168	215	PS50081	Protein kinase C
	IPR000219	363	560	PS50010	DH
	IPR001849	600	699	PS50003	Pleckstrin-like
ScanRegExp	IPR002219	169	215	PS00479	Protein kinase C

Primer_f	GCCTCCTATCTCCACATCTCT
Primer_r	GGGAAGAGGTCAGTATAGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCCTCCTATCTCCACATCTCT
Primer_r	GGGAAGAGGTCAGTATAGGTC
PCR product length	100 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles