HUGE

Gene/Protein Characteristic Table for KIAA1664

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00262
Accession No. :	AB051451
Description :	Oxysterol-binding protein 2.
HUGO Gene Name :	oxysterol binding protein 2 (OSBP2)
Clone Name :	fj04751s1 [Vector Info]
Flexi ORF Clone :	pF1KA1664
Source :	Human fetal brain
Note :	We replaced fj04751, former representative clones for KIAA1664 with fj04751s1. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 4244 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1481 bp

Genome contig ID gi89161203f_29320885
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
ACCAGTAATAAAAAACCTTGGCTTTGGAGTTTTCC
Flanking genome sequence
(312924 - 312973)
----+----*----+----*----+----*----+----*----+----*
ACTGCCCTGTCCCTCAGTCTCTGTGTATCTGGGTGGAGGGGACTAATGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 29420885 29633807 14 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 920 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10478	100.0	oxysterol-bindi...	synthetic construct
Q969R2	99.9	Oxysterol-bindi...	Homo sapiens
AAI18915	99.8	Oxysterol bindi...	Homo sapiens
AAK56864	100.0	oxysterol bindi...	Homo sapiens
XP_525565	93.6	oxysterol bindi...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014604	2.1e-19	33.5	KIAA0704
AB018315	3.9e-18	36.9	KIAA0772
AB040967	3.2e-07	27.4	KIAA1534
AB040884	3e-06	25.3	KIAA1451

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 187 278 PF00169 Pleckstrin-like

IPR000648 488 910 PF01237 Oxysterol-binding protein

HMMSmart IPR001849 187 280 SM00233 Pleckstrin-like

ProfileScan IPR001849 186 278 PS50003 Pleckstrin-like

ScanRegExp IPR000648 626 636 PS01013 Oxysterol-binding protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	187	278	PF00169	Pleckstrin-like
IPR000648	488	910	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	187	280	SM00233	Pleckstrin-like
ProfileScan	IPR001849	186	278	PS50003	Pleckstrin-like
ScanRegExp	IPR000648	626	636	PS01013	Oxysterol-binding protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1481 bp
Genome contig ID	gi89161203f_29320885
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- ACCAGTAATAAAAAACCTTGGCTTTGGAGTTTTCC
Flanking genome sequence (312924 - 312973)	----+--------+--------+--------+--------+----* ACTGCCCTGTCCCTCAGTCTCTGTGTATCTGGGTGGAGGGGACTAATGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	29420885	29633807	14	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1664

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information