Order Kazusa clone(s) from : ![]() |
Product ID | ORK00452 |
---|---|
Accession No | D83784 |
Description | pleiomorphic adenoma gene-like 2 |
Clone name | ha02521 |
Vector information | |
cDNA sequence | DNA sequence (5638 bp) Predicted protein sequence (562 aa) |
HaloTag ORF Clone |
FHC00452
![]() |
Flexi ORF Clone | FXC00452 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0198
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3947 bp |
---|---|
Genome contig ID | gi51511747r_30143968 |
PolyA signal sequence (ATTAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 30243968 | 30259190 | 3 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 134 | 158 | PF00096 | Zinc finger |
IPR007087 | 164 | 186 | PF00096 | Zinc finger | |
IPR007087 | 193 | 215 | PF00096 | Zinc finger | |
IPR007087 | 222 | 244 | PF00096 | Zinc finger | |
IPR007087 | 257 | 279 | PF00096 | Zinc finger | |
IPR007087 | 285 | 308 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 134 | 158 | SM00355 | Zinc finger |
IPR015880 | 164 | 186 | SM00355 | Zinc finger | |
IPR015880 | 193 | 215 | SM00355 | Zinc finger | |
IPR015880 | 222 | 244 | SM00355 | Zinc finger | |
IPR015880 | 257 | 279 | SM00355 | Zinc finger | |
IPR015880 | 285 | 308 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 134 | 163 | PS50157 | Zinc finger |
IPR007087 | 164 | 191 | PS50157 | Zinc finger | |
IPR007087 | 193 | 220 | PS50157 | Zinc finger | |
IPR007087 | 222 | 249 | PS50157 | Zinc finger | |
IPR007087 | 257 | 284 | PS50157 | Zinc finger | |
IPR007087 | 285 | 313 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 136 | 158 | PS00028 | Zinc finger |
IPR007087 | 166 | 186 | PS00028 | Zinc finger | |
IPR007087 | 195 | 215 | PS00028 | Zinc finger | |
IPR007087 | 224 | 244 | PS00028 | Zinc finger | |
IPR007087 | 259 | 279 | PS00028 | Zinc finger | |
IPR007087 | 287 | 308 | PS00028 | Zinc finger |
Panel name | Genebridge 4 |
---|---|
Primer_f | TAGCTGATTGTTCCCACTTGC |
Primer_r | CTGGAGTTACAAAAGAGTGGC |
PCR product length | 123 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |