KIAA0711

Product ID	ORK05564
Accession No	AB018254
Description	kelch repeat and BTB (POZ) domain containing 11
Clone name	hg00358
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hg00358 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6706 bp) Predicted protein sequence (661 aa)
Source	Human adult brain
Rouge ID	mKIAA0711 by Kazusa Mouse cDNA Project

Length: 6706 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3871 bp
Genome contig ID	gi51511724f_1809451
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CCGAGATGAAATAAATCACGCAGAAAGTGCCAGTC
Flanking genome sequence (133060 - 133109)	----+--------+--------+--------+--------+----* CTCCTGATGTGCCCCGAGTGCTTTTCTCTTTCTCCACAGCGAGCGTCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	1909451	1942509	2	99.0	Perfect prediction

Length: 661 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94819	9.8e-212	100.0	Kelch repeat an...	Homo sapiens
Q8BNW9	8.9e-165	80.5	Kelch repeat an...	Mus musculus
AAH80858	1.4e-164	80.3	Kbtbd11 protein...	Mus musculus
BAC37803	2.3e-164	80.2	unnamed protein...	Mus musculus
XP_001381495	9.7e-114	57.8	hypothetical pr...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037761	1.1e-09	29.9	KIAA1340
AB037775	4.9e-07	29.1	KIAA1354
AB037730	1.9e-06	28.1	KIAA1309
D50922	1.2e-05	31.7	KIAA0132
AB067487	3.4e-05	24.2	KIAA1900

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	171	269	PF00651	BTB/POZ
	IPR006652	386	437	PF01344	Kelch repeat type 1
	IPR006652	439	480	PF01344	Kelch repeat type 1
	IPR006652	484	525	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	178	269	SM00225	BTB/POZ-like
	IPR006652	398	450	SM00612	Kelch repeat type 1
	IPR006652	451	495	SM00612	Kelch repeat type 1
	IPR006652	496	538	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	178	234	PS50097	BTB/POZ-like

Primer_f	TCCTCCAAAGCCTGTTCAAGC
Primer_r	GAACTGACAAACATACGAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCTCCAAAGCCTGTTCAAGC
Primer_r	GAACTGACAAACATACGAGGC
PCR product length	185 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles