KIAA1340

Product ID	ORK05757
Accession No	AB037761
Description	kelch-like family member 42
Clone name	fj00164
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3876 bp) Predicted protein sequence (441 aa)
Source	Human fetal brain
Rouge ID	mKIAA1340 by Kazusa Mouse cDNA Project

Length: 3876 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2550 bp
Genome contig ID	gi89161190f_27724723
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCGACAGTGCAAGACTCTGTCTTC
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	27824723	27854900	4	99.1	Terminal No-hit

Length: 441 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH28742	1.7e-194	100.0	KLHDC5 protein ...	Homo sapiens
Q9P2K6	1.8e-194	100.0	Kelch domain-co...	Homo sapiens
XP_001916434	2.3e-190	97.7	kelch domain co...	Equus caballus
XP_001249627	2.8e-185	95.2	similar to kelc...	Bos taurus
EAW96570	1.1e-179	100.0	kelch domain co...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018254	1.1e-20	29.6	KIAA0711
AB037775	1.3e-17	25.0	KIAA1354
AB037730	2e-17	25.4	KIAA1309
AB037805	8.9e-15	25.7	KIAA1384
AB067508	1.5e-10	24.3	KIAA1921

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011705	66	105	PF07707	BTB/Kelch-associated
	IPR006652	178	224	PF01344	Kelch repeat type 1
	IPR006652	226	267	PF01344	Kelch repeat type 1
	IPR006652	269	308	PF01344	Kelch repeat type 1
	IPR006652	316	371	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	190	237	SM00612	Kelch repeat type 1
	IPR006652	238	280	SM00612	Kelch repeat type 1
	IPR006652	281	327	SM00612	Kelch repeat type 1

Primer_f	AAAGGTGGAATGTGCAATAGG
Primer_r	CTTCAATGTAATACTGGCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-