Order Kazusa clone(s) from : ![]() |
Product ID | ORK05768 |
---|---|
Accession No | AB067508 |
Description | kelch-like family member 29 |
Clone name | fg00938 |
Vector information | |
cDNA sequence | DNA sequence (6385 bp) Predicted protein sequence (545 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1921
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1947 bp |
---|---|
Genome contig ID | gi89161199f_23665160 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (119827 - 119876) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 23765160 | 23784985 | 8 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 26 | 101 | PF00651 | BTB/POZ |
IPR011705 | 106 | 208 | PF07707 | BTB/Kelch-associated | |
IPR011498 | 243 | 292 | PF07646 | Kelch repeat type 2 | |
IPR006652 | 295 | 340 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 342 | 387 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 389 | 435 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 480 | 527 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR006652 | 255 | 306 | SM00612 | Kelch repeat type 1 |
IPR006652 | 307 | 353 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 354 | 400 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 401 | 448 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 449 | 491 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 492 | 540 | SM00612 | Kelch repeat type 1 |
![]() |
Primer_f | GCGCTGTTGAGTTGAAGTTGG |
---|---|
Primer_r | TCGTAGTGCTAGAAGTTGATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |