KIAA1231

Product ID	ORK01156
Accession No	AB033057
Description	PR domain containing 10, transcript variant 3
Clone name	fh08195s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5782 bp) Predicted protein sequence (1061 aa)
HaloTag ORF Clone	FHC01156
Flexi ORF Clone	FXC01156
Source	Human fetal brain
Note	We replaced fh08195, former representative clones for KIAA1231 with fh08195s1. (2002/12/27)

Length: 5782 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2596 bp
Genome contig ID	gi51511727r_129174822
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAATATATTTTTTAATAAACATGTTTGTATGTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTACAAGAGCTATTTTTTTTTCTTTGAAGAATTGCAACTTTTGGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	129274822	129322511	17	99.4	Perfect prediction

Length: 1061 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW67764	99.6	hCG1730378, iso...	Homo sapiens
EAW67760	99.3	hCG1730378, iso...	Homo sapiens
CAH91081	98.5	hypothetical pr...	Pongo abelii
XP_001152345	92.7	PR domain conta...	Pan troglodytes
AAI43613	98.8	Unknown (protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075834	4.8e-12	27.6	KIAA1954
AB046779	9.6e-12	30.3	KIAA1559
AB051497	2.4e-11	25.8	KIAA1710
AB014528	2.7e-11	29.7	KIAA0628
AB037770	3.4e-11	29.5	KIAA1349

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	269	291	PF00096	Zinc finger
	IPR007087	444	466	PF00096	Zinc finger
	IPR007087	474	496	PF00096	Zinc finger
	IPR007087	502	524	PF00096	Zinc finger
	IPR007087	530	553	PF00096	Zinc finger
	IPR007087	558	580	PF00096	Zinc finger
	IPR007087	586	609	PF00096	Zinc finger
	IPR007087	686	709	PF00096	Zinc finger
HMMSmart	IPR015880	269	291	SM00355	Zinc finger
	IPR015880	444	466	SM00355	Zinc finger
	IPR015880	474	496	SM00355	Zinc finger
	IPR015880	502	524	SM00355	Zinc finger
	IPR015880	530	553	SM00355	Zinc finger
	IPR015880	558	580	SM00355	Zinc finger
	IPR015880	586	609	SM00355	Zinc finger
	IPR015880	641	664	SM00355	Zinc finger
	IPR015880	686	709	SM00355	Zinc finger
	IPR015880	748	771	SM00355	Zinc finger
ProfileScan	IPR007087	269	296	PS50157	Zinc finger
	IPR007087	444	471	PS50157	Zinc finger
	IPR007087	474	501	PS50157	Zinc finger
	IPR007087	502	529	PS50157	Zinc finger
	IPR007087	530	554	PS50157	Zinc finger
	IPR007087	558	585	PS50157	Zinc finger
	IPR007087	586	614	PS50157	Zinc finger
	IPR007087	641	669	PS50157	Zinc finger
	IPR007087	686	714	PS50157	Zinc finger
	IPR007087	748	771	PS50157	Zinc finger
ScanRegExp	IPR007087	271	291	PS00028	Zinc finger
	IPR007087	446	466	PS00028	Zinc finger
	IPR007087	476	496	PS00028	Zinc finger
	IPR007087	504	524	PS00028	Zinc finger
	IPR007087	532	553	PS00028	Zinc finger
	IPR007087	560	580	PS00028	Zinc finger
	IPR007087	588	609	PS00028	Zinc finger
	IPR007087	643	664	PS00028	Zinc finger
	IPR007087	688	709	PS00028	Zinc finger
	IPR007087	749	771	PS00028	Zinc finger

Primer_f	GGAAACTGAAAATGGACTCTC
Primer_r	TCATTACACTGTGGGACTTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGAAACTGAAAATGGACTCTC
Primer_r	TCATTACACTGTGGGACTTAG
PCR product length	106 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles