KIAA1368

Product ID	ORK00816
Accession No	AB037789
Description	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A, transcript variant 1
Clone name	fj03125
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4250 bp) Predicted protein sequence (1049 aa)
HaloTag ORF Clone	FHC00816
Flexi ORF Clone	FXC00816
Source	Human fetal brain

Length: 4250 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	857 bp
Genome contig ID	gi51511721r_115709345
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTCTTTATTTTTACAATAAATTCACTGAGTAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTTGGAGCTGGAATTCTGAGCTTTGTGTTTGGACTGTCTGGTCTGTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	115809345	115937990	20	99.5	Perfect prediction

Length: 1049 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW48937	100.0	sema domain, tr...	Homo sapiens
XP_517889	99.7	sema domain, tr...	Pan troglodytes
XP_538552	95.7	similar to sema...	Canis lupus fam...
XP_858886	92.7	similar to sema...	Canis lupus fam...
Q9H2E6	98.4	Semaphorin-6A; ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040912	2.4e-95	45.3	KIAA1479
AB058772	2.9e-71	38.7	KIAA1869
AB040878	1.2e-29	34.2	KIAA1445
AB002329	6.6e-25	31.8	KIAA0331
AB051526	6e-22	31.4	KIAA1739

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	58	493	PF01403	Semaphorin/CD100 antigen
HMMPfam	IPR002165	516	567	PF01437	Plexin
HMMSmart	IPR001627	58	489	SM00630	Semaphorin/CD100 antigen
HMMSmart	IPR003659	516	571	SM00423	Plexin/semaphorin/integrin
ProfileScan	IPR001627	26	514	PS51004	Semaphorin/CD100 antigen

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2	TMRSEALLLYFTLLHFAGAGFP	23	SECONDARY	22
SOSUI2	2	668	TLLAIAVILAFVMGAVFSGITVY	690	PRIMARY	23

Primer_f	TTTTGAGCAGGACATAGAGCG
Primer_r	GAATCTGATGTGGTTGTGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-