Order Kazusa clone(s) from : ![]() |
Product ID | ORK00224 |
---|---|
Accession No | AB037805 |
Description | kelch-like family member 14 |
Clone name | fj06146 |
Vector information | |
cDNA sequence | DNA sequence (4261 bp) Predicted protein sequence (652 aa) |
HaloTag ORF Clone |
FHC00224
![]() |
Flexi ORF Clone | FXC00224 |
Source | Human fetal brain |
Rouge ID |
mKIAA1384
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1986 bp |
---|---|
Genome contig ID | gi51511735r_28406632 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 18 | r | 28506632 | 28606972 | 9 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 47 | 205 | PF00651 | BTB/POZ |
IPR011705 | 210 | 303 | PF07707 | BTB/Kelch-associated | |
IPR006652 | 335 | 383 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 385 | 435 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 437 | 482 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 484 | 529 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 531 | 580 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 583 | 626 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR000210 | 57 | 205 | SM00225 | BTB/POZ-like |
IPR006652 | 347 | 396 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 397 | 448 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 449 | 495 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 496 | 542 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 543 | 594 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 595 | 644 | SM00612 | Kelch repeat type 1 | |
ProfileScan | IPR000210 | 57 | 175 | PS50097 | BTB/POZ-like |
![]() |
Primer_f | ATGTGCTGCTGCTCAACTTCG |
---|---|
Primer_r | TCGCATGAAATCCACTGACTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |