KIAA0198

Product ID	ORK00452
Accession No	D83784
Description	pleiomorphic adenoma gene-like 2
Clone name	ha02521
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5638 bp) Predicted protein sequence (562 aa)
HaloTag ORF Clone	FHC00452
Flexi ORF Clone	FXC00452
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0198 by Kazusa Mouse cDNA Project

Length: 5638 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3947 bp
Genome contig ID	gi51511747r_30143968
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- GAAGTTGTTTATTAAAAACTTCTGAATGATGTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGGGAGTTGTGAACCTGTCTGATTGGGAAACGGTTGGAGAGAGCCTCGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	30243968	30259190	3	99.1	Perfect prediction

Length: 562 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPG8	2.9e-190	100.0	Zinc finger pro...	Homo sapiens
XP_542953	6.1e-189	99.0	similar to Zinc...	Canis lupus fam...
BAB56160	1.1e-187	98.6	PLAGL2 [Mus mus...	Mus musculus
EDL06019	1.9e-187	98.4	pleiomorphic ad...	Mus musculus
XP_001500175	2.5e-187	98.2	similar to plei...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037817	2.6e-09	27.0	KIAA1396
AB037852	3.1e-09	30.2	KIAA1431
AB023141	1.3e-08	24.8	KIAA0924
AB037770	7.9e-08	31.2	KIAA1349
AB037809	1.1e-07	28.3	KIAA1388

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	134	158	PF00096	Zinc finger
	IPR007087	164	186	PF00096	Zinc finger
	IPR007087	193	215	PF00096	Zinc finger
	IPR007087	222	244	PF00096	Zinc finger
	IPR007087	257	279	PF00096	Zinc finger
	IPR007087	285	308	PF00096	Zinc finger
HMMSmart	IPR015880	134	158	SM00355	Zinc finger
	IPR015880	164	186	SM00355	Zinc finger
	IPR015880	193	215	SM00355	Zinc finger
	IPR015880	222	244	SM00355	Zinc finger
	IPR015880	257	279	SM00355	Zinc finger
	IPR015880	285	308	SM00355	Zinc finger
ProfileScan	IPR007087	134	163	PS50157	Zinc finger
	IPR007087	164	191	PS50157	Zinc finger
	IPR007087	193	220	PS50157	Zinc finger
	IPR007087	222	249	PS50157	Zinc finger
	IPR007087	257	284	PS50157	Zinc finger
	IPR007087	285	313	PS50157	Zinc finger
ScanRegExp	IPR007087	136	158	PS00028	Zinc finger
	IPR007087	166	186	PS00028	Zinc finger
	IPR007087	195	215	PS00028	Zinc finger
	IPR007087	224	244	PS00028	Zinc finger
	IPR007087	259	279	PS00028	Zinc finger
	IPR007087	287	308	PS00028	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TAGCTGATTGTTCCCACTTGC
Primer_r	CTGGAGTTACAAAAGAGTGGC
PCR product length	123 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles