|
Order Kazusa clone(s) from : |
| Product ID | ORK00565 |
|---|---|
| Accession No | AB011148 |
| Description | zinc finger protein 451, transcript variant 1 |
| Clone name | hj00261 |
| Vector information | |
| cDNA sequence | DNA sequence (4961 bp) Predicted protein sequence (1075 aa) |
|
HaloTag ORF Clone |
FHC00565
|
| Flexi ORF Clone | FXC00565 |
| Source | Human adult brain |
Length: 4961 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1075 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR007087 | 512 | 535 | PF00096 | Zinc finger |
| HMMSmart | IPR015880 | 183 | 209 | SM00355 | Zinc finger |
| IPR015880 | 226 | 246 | SM00355 | Zinc finger | |
| IPR015880 | 267 | 291 | SM00355 | Zinc finger | |
| IPR015880 | 329 | 351 | SM00355 | Zinc finger | |
| IPR015880 | 376 | 400 | SM00355 | Zinc finger | |
| IPR015880 | 512 | 535 | SM00355 | Zinc finger | |
| IPR015880 | 545 | 568 | SM00355 | Zinc finger | |
| IPR015880 | 620 | 645 | SM00355 | Zinc finger | |
| IPR015880 | 650 | 673 | SM00355 | Zinc finger | |
| IPR015880 | 681 | 703 | SM00355 | Zinc finger | |
| IPR015880 | 767 | 790 | SM00355 | Zinc finger | |
| IPR015880 | 803 | 826 | SM00355 | Zinc finger | |
| ProfileScan | IPR007087 | 183 | 214 | PS50157 | Zinc finger |
| IPR007087 | 329 | 351 | PS50157 | Zinc finger | |
| IPR007087 | 512 | 540 | PS50157 | Zinc finger | |
| IPR007087 | 545 | 573 | PS50157 | Zinc finger | |
| IPR007087 | 650 | 678 | PS50157 | Zinc finger | |
| ScanRegExp | IPR007087 | 185 | 209 | PS00028 | Zinc finger |
| IPR007087 | 269 | 291 | PS00028 | Zinc finger | |
| IPR007087 | 331 | 351 | PS00028 | Zinc finger | |
| IPR007087 | 378 | 400 | PS00028 | Zinc finger | |
| IPR007087 | 514 | 535 | PS00028 | Zinc finger | |
| IPR007087 | 547 | 568 | PS00028 | Zinc finger | |
| IPR007087 | 652 | 673 | PS00028 | Zinc finger | |
| IPR007087 | 683 | 704 | PS00028 | Zinc finger | |
| IPR007087 | 805 | 826 | PS00028 | Zinc finger |
RT-PCR
|
|---|
Experimental conditions| Primer_f | TGTTTAAGTGGTCAAGCAAGG |
|---|---|
| Primer_r | CCATTTTGTGAGCTCCTGCAG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 6
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TGTTTAAGTGGTCAAGCAAGG |
| Primer_r | CCATTTTGTGAGCTCCTGCAG |
| PCR product length | 80 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |