Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00565 |
---|---|
Accession No | AB011148 |
Description | zinc finger protein 451, transcript variant 1 |
Clone name | hj00261 |
Vector information | |
cDNA sequence | DNA sequence (4961 bp) Predicted protein sequence (1075 aa) |
HaloTag ORF Clone |
FHC00565
|
Flexi ORF Clone | FXC00565 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 512 | 535 | PF00096 | Zinc finger |
HMMSmart | IPR015880 | 183 | 209 | SM00355 | Zinc finger |
IPR015880 | 226 | 246 | SM00355 | Zinc finger | |
IPR015880 | 267 | 291 | SM00355 | Zinc finger | |
IPR015880 | 329 | 351 | SM00355 | Zinc finger | |
IPR015880 | 376 | 400 | SM00355 | Zinc finger | |
IPR015880 | 512 | 535 | SM00355 | Zinc finger | |
IPR015880 | 545 | 568 | SM00355 | Zinc finger | |
IPR015880 | 620 | 645 | SM00355 | Zinc finger | |
IPR015880 | 650 | 673 | SM00355 | Zinc finger | |
IPR015880 | 681 | 703 | SM00355 | Zinc finger | |
IPR015880 | 767 | 790 | SM00355 | Zinc finger | |
IPR015880 | 803 | 826 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 183 | 214 | PS50157 | Zinc finger |
IPR007087 | 329 | 351 | PS50157 | Zinc finger | |
IPR007087 | 512 | 540 | PS50157 | Zinc finger | |
IPR007087 | 545 | 573 | PS50157 | Zinc finger | |
IPR007087 | 650 | 678 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 185 | 209 | PS00028 | Zinc finger |
IPR007087 | 269 | 291 | PS00028 | Zinc finger | |
IPR007087 | 331 | 351 | PS00028 | Zinc finger | |
IPR007087 | 378 | 400 | PS00028 | Zinc finger | |
IPR007087 | 514 | 535 | PS00028 | Zinc finger | |
IPR007087 | 547 | 568 | PS00028 | Zinc finger | |
IPR007087 | 652 | 673 | PS00028 | Zinc finger | |
IPR007087 | 683 | 704 | PS00028 | Zinc finger | |
IPR007087 | 805 | 826 | PS00028 | Zinc finger |
RT-PCR |
---|
Primer_f | TGTTTAAGTGGTCAAGCAAGG |
---|---|
Primer_r | CCATTTTGTGAGCTCCTGCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGTTTAAGTGGTCAAGCAAGG |
Primer_r | CCATTTTGTGAGCTCCTGCAG |
PCR product length | 80 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |