Gene/Protein Characteristic Table for KIAA0576
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00565
Accession No AB011148
Description zinc finger protein 451, transcript variant 1
Clone name hj00261
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4961 bp)
Predicted protein sequence (1075 aa)
Flexi ORF Clone FXC00565
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4961 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1075 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_518562 0 99.4 zinc finger pro...
Pan troglodytes
Q9Y4E5 0 100.0 Zinc finger pro...
Homo sapiens
ACE86936 0 99.8 zinc finger pro...
synthetic construct
XP_001105455 0 97.2 zinc finger pro...
Macaca mulatta
NP_001125606 0 98.2 zinc finger pro...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 0.00014 23.5 KIAA1611
AB007901 0.00016 21.2 KIAA0441
AB018303 0.00033 21.0 KIAA0760
AB046779 0.00035 21.9 KIAA1559
AB075836 0.00038 22.5 KIAA1956
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 512 535 PF00096 Zinc finger
HMMSmart IPR015880 183 209 SM00355 Zinc finger
IPR015880 226 246 SM00355 Zinc finger
IPR015880 267 291 SM00355 Zinc finger
IPR015880 329 351 SM00355 Zinc finger
IPR015880 376 400 SM00355 Zinc finger
IPR015880 512 535 SM00355 Zinc finger
IPR015880 545 568 SM00355 Zinc finger
IPR015880 620 645 SM00355 Zinc finger
IPR015880 650 673 SM00355 Zinc finger
IPR015880 681 703 SM00355 Zinc finger
IPR015880 767 790 SM00355 Zinc finger
IPR015880 803 826 SM00355 Zinc finger
ProfileScan IPR007087 183 214 PS50157 Zinc finger
IPR007087 329 351 PS50157 Zinc finger
IPR007087 512 540 PS50157 Zinc finger
IPR007087 545 573 PS50157 Zinc finger
IPR007087 650 678 PS50157 Zinc finger
ScanRegExp IPR007087 185 209 PS00028 Zinc finger
IPR007087 269 291 PS00028 Zinc finger
IPR007087 331 351 PS00028 Zinc finger
IPR007087 378 400 PS00028 Zinc finger
IPR007087 514 535 PS00028 Zinc finger
IPR007087 547 568 PS00028 Zinc finger
IPR007087 652 673 PS00028 Zinc finger
IPR007087 683 704 PS00028 Zinc finger
IPR007087 805 826 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TGTTTAAGTGGTCAAGCAAGG
Primer_r CCATTTTGTGAGCTCCTGCAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f TGTTTAAGTGGTCAAGCAAGG
Primer_r CCATTTTGTGAGCTCCTGCAG
PCR product length 80 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp