KIAA1122

Product ID	ORK01153
Accession No	AB032948
Description	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1, transcript variant 1
Clone name	hj01698
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4906 bp) Predicted protein sequence (1040 aa)
HaloTag ORF Clone	FHC01153
Flexi ORF Clone	FXC01153
Source	Human adult brain
Rouge ID	mKIAA1122 by Kazusa Mouse cDNA Project

Length: 4906 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1756 bp
Genome contig ID	gi89161207f_95248520
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATGTCTTGGGCTTAATAAAAATATTTGTGATCAT
Flanking genome sequence (182946 - 182995)	----+--------+--------+--------+--------+----* AAGTTGTATTTTCACACCCTTTTTAATAGTTTCTAACCCTTCCTCCTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	95347896	95431464	24	100.0	Perfect prediction

Length: 1040 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX06051	100.0	SWI/SNF-related...	Homo sapiens
EAX06050	99.8	SWI/SNF-related...	Homo sapiens
AAH45534	99.6	SWI/SNF-related...	Homo sapiens
Q9H4L7	99.7	SWI/SNF-related...	Homo sapiens
XP_001251200	96.8	similar to SWI/...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	3.2e-18	29.5	KIAA0309
AB033085	3.3e-18	26.0	KIAA1259
AB040931	1.1e-15	27.0	KIAA1498
AB046784	4.7e-15	25.6	KIAA1564
AB007913	1.5e-14	41.6	KIAA0444

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	512	802	PF00176	SNF2-related
HMMPfam	IPR001650	903	981	PF00271	Helicase
HMMSmart	IPR011545	505	699	SM00487	DEAD/DEAH box helicase
HMMSmart	IPR001650	898	981	SM00490	Helicase

Primer_f	GTTTATTACTGCCACATCTCC
Primer_r	GACCTATTTCCATGCAGTACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-