KIAA0952

Product ID	ORK00694
Accession No	AB023169
Description	BTB (POZ) domain containing 3, transcript variant 1
Clone name	hj05359
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4856 bp) Predicted protein sequence (539 aa)
HaloTag ORF Clone	FHC00694
Flexi ORF Clone	FXC00694
Source	Human adult brain
Rouge ID	mKIAA0952 by Kazusa Mouse cDNA Project

Length: 4856 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2928 bp
Genome contig ID	gi51511747f_11746567
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TAATCATGTTAAATGCAAATAAAACTAGTTCATAG
Flanking genome sequence (108677 - 108726)	----+--------+--------+--------+--------+----* ATTTGTTTTCCTTTAGTGCTTTTGTCACACCCTTGAGATAGTAAAAAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	11846565	11855242	4	99.0	Perfect prediction

Length: 539 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2F9	100.0	BTB/POZ domain-...	Homo sapiens
XP_001492736	98.9	BTB (POZ) domai...	Equus caballus
XP_534344	98.1	similar to BTB/...	Canis lupus fam...
EDL80315	96.6	BTB (POZ) domai...	Rattus norvegicus
AAH62968	96.2	BTB (POZ) domai...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067467	8.2e-14	29.3	KIAA1880
AB037799	6.9e-10	24.7	KIAA1378
D50922	4e-09	23.6	KIAA0132
AB032955	3.4e-08	24.3	KIAA1129
AB051474	1.5e-07	23.5	KIAA1687

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	132	237	PF00651	BTB/POZ
HMMPfam	IPR012983	393	539	PF08005	PHR
HMMSmart	IPR000210	137	237	SM00225	BTB/POZ-like
ProfileScan	IPR000210	137	207	PS50097	BTB/POZ-like

Primer_f	TGAAAGTCGTGTGAAATCCTG
Primer_r	CTCTCGGTACCAGCCAATCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-