KIAA0696

Product ID	ORK00609
Accession No	AB014596
Description	F-box and WD repeat domain containing 11, transcript variant 3
Clone name	hk04053
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4230 bp) Predicted protein sequence (550 aa)
HaloTag ORF Clone	FHC00609
Flexi ORF Clone	FXC00609
Source	Human adult brain
Rouge ID	mKIAA0696 by Kazusa Mouse cDNA Project

Length: 4230 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2576 bp
Genome contig ID	gi51511721r_171121161
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAAGCCAATACTCTTAATAAAGTGTTGCAATACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGACGTTCTGTTAAGAAATTTTTCAAAGAAACTGTTAAGTGCTGTTAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	171221161	171366136	13	99.4	Perfect prediction

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UKB1	0	100.0	F-box/WD repeat...	Homo sapiens
CAI25520	0	99.6	F-box and WD-40...	Mus musculus
BAG58031	4e-215	100.0	unnamed protein...	Homo sapiens
BAA92330	4.1e-215	94.3	F-box and WD-re...	Homo sapiens
XP_001499717	4.1e-215	94.3	F-box and WD re...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007873	8.5e-08	26.8	KIAA0413
AB040882	1.9e-05	27.9	KIAA1449
AB033068	3e-05	22.6	KIAA1242
AB007918	4.4e-05	25.9	KIAA0449
AB011168	8.1e-05	24.6	KIAA0596

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	247	274	PD000018	WD40 repeat
	IPR001680	283	315	PD000018	WD40 repeat
	IPR001680	366	398	PD000018	WD40 repeat
	IPR001680	406	438	PD000018	WD40 repeat
	IPR001680	446	478	PD000018	WD40 repeat
FPrintScan	IPR001680	301	315	PR00320	WD40 repeat
	IPR001680	424	438	PR00320	WD40 repeat
	IPR001680	464	478	PR00320	WD40 repeat
HMMPfam	IPR001810	126	177	PF00646	Cyclin-like F-box
	IPR001680	238	274	PF00400	WD40 repeat
	IPR001680	278	314	PF00400	WD40 repeat
	IPR001680	318	354	PF00400	WD40 repeat
	IPR001680	361	397	PF00400	WD40 repeat
	IPR001680	401	437	PF00400	WD40 repeat
	IPR001680	441	477	PF00400	WD40 repeat
	IPR001680	490	526	PF00400	WD40 repeat
HMMSmart	IPR001810	136	175	SM00256	Cyclin-like F-box
	IPR001680	237	274	SM00320	WD40 repeat
	IPR001680	277	314	SM00320	WD40 repeat
	IPR001680	317	354	SM00320	WD40 repeat
	IPR001680	360	397	SM00320	WD40 repeat
	IPR001680	400	437	SM00320	WD40 repeat
	IPR001680	440	477	SM00320	WD40 repeat
	IPR001680	489	526	SM00320	WD40 repeat
ProfileScan	IPR001810	137	175	PS50181	Cyclin-like F-box
	IPR001680	244	283	PS50082	WD40 repeat
	IPR001680	244	535	PS50294	WD40 repeat
	IPR001680	284	323	PS50082	WD40 repeat
	IPR001680	324	363	PS50082	WD40 repeat
	IPR001680	367	406	PS50082	WD40 repeat
	IPR001680	407	446	PS50082	WD40 repeat
	IPR001680	447	479	PS50082	WD40 repeat
	IPR001680	496	526	PS50082	WD40 repeat
ScanRegExp	IPR001680	301	315	PS00678	WD40 repeat
	IPR001680	341	355	PS00678	WD40 repeat
	IPR001680	424	438	PS00678	WD40 repeat
	IPR001680	464	478	PS00678	WD40 repeat
	IPR001680	513	527	PS00678	WD40 repeat

Primer_f	AGCTTTGTACTGTGGAATGTG
Primer_r	ATTGCATGAAGCCAGATTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGCTTTGTACTGTGGAATGTG
Primer_r	ATTGCATGAAGCCAGATTAGG
PCR product length	128 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles