KIAA0848

Product ID	ORK00657
Accession No	AB020655
Description	SLIT and NTRK-like family, member 3
Clone name	hk05607
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4220 bp) Predicted protein sequence (988 aa)
HaloTag ORF Clone	FHC00657
Flexi ORF Clone	FXC00657
Source	Human adult brain

Length: 4220 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1175 bp
Genome contig ID	gi89161205r_166287204
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TATAGCTTTCCTAATAAAAAGTTTTTGAAAAACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACATTATATATAGAGGATACAAAGCTTGAACCTTAAACTCCAGCTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	166387204	166397163	2	99.0	Perfect prediction

Length: 988 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_526372	99.6	slit and trk li...	Pan troglodytes
BAG09869	100.0	SLIT and NTRK-l...	synthetic construct
O94933	99.9	SLIT and NTRK-l...	Homo sapiens
XP_851171	98.3	similar to slit...	Canis lupus fam...
XP_001504616	97.4	SLIT and NTRK-l...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020725	1.6e-78	42.2	KIAA0918
AB058757	1.8e-34	50.3	KIAA1854
AB067497	1.2e-27	38.9	KIAA1910
AB011538	5.7e-09	25.3	KIAA0814
AB007865	8.1e-07	27.9	KIAA0405

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	209	222	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	466	479	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	113	135	PF00560	Leucine-rich repeat
	IPR001611	161	183	PF00560	Leucine-rich repeat
	IPR001611	185	207	PF00560	Leucine-rich repeat
	IPR001611	208	231	PF00560	Leucine-rich repeat
	IPR001611	420	442	PF00560	Leucine-rich repeat
	IPR001611	444	466	PF00560	Leucine-rich repeat
	IPR001611	468	490	PF00560	Leucine-rich repeat
	IPR001611	492	514	PF00560	Leucine-rich repeat
	IPR001611	516	538	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	111	134	SM00369	Leucine-rich repeat
	IPR003591	135	158	SM00369	Leucine-rich repeat
	IPR003591	159	182	SM00369	Leucine-rich repeat
	IPR003591	183	206	SM00369	Leucine-rich repeat
	IPR003591	207	230	SM00369	Leucine-rich repeat
	IPR000483	243	293	SM00082	Cysteine-rich flanking region
	IPR003591	442	465	SM00369	Leucine-rich repeat
	IPR003591	466	489	SM00369	Leucine-rich repeat
	IPR003591	490	513	SM00369	Leucine-rich repeat
	IPR003591	514	537	SM00369	Leucine-rich repeat
	IPR000483	573	623	SM00082	Cysteine-rich flanking region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	24	RMLWIILLSTIALGWTTPIPLIE	46	PRIMARY	23
SOSUI2	2	665	SVLILSLLVLFFSAVFVAAGLFA	687	PRIMARY	23

Primer_f	CTTGCTCCCTTTACACTTGTC
Primer_r	TTAATGATCTGAGTATGGCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTGCTCCCTTTACACTTGTC
Primer_r	TTAATGATCTGAGTATGGCCC
PCR product length	151 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles