KIAA1095

Product ID	ORK00740
Accession No	AB029018
Description	PDZ domain containing ring finger 3, transcript variant 1
Clone name	hk06736
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk06736 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4161 bp) Predicted protein sequence (1098 aa)
HaloTag ORF Clone	FHC00740
Flexi ORF Clone	FXC00740
Source	Human adult brain
Rouge ID	mKIAA1095 by Kazusa Mouse cDNA Project

Length: 4161 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	864 bp
Genome contig ID	gi89161205r_73414342
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CAGTAAAATGAAGTTAAAATAAATTATTATTTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGATATGTTTTGATGTGATTCCTCATTTTGCAGTGGTGCCTATAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	73514342	73756762	10	99.8	Perfect prediction

Length: 1098 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001098466	98.4	similar to PDZ ...	Macaca mulatta
Q9UPQ7	100.0	PDZ domain-cont...	Homo sapiens
AAI50624	99.9	PDZ domain cont...	Homo sapiens
XP_516586	99.7	PDZ domain cont...	Pan troglodytes
Q69ZS0	94.4	PDZ domain-cont...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040877	1.6e-41	49.9	KIAA1444
D63481	1.2e-05	30.1	KIAA0147

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	50	88	PF00097	Zinc finger
	IPR001293	133	171	PF02176	Zinc finger
	IPR001478	281	368	PF00595	PDZ/DHR/GLGF
	IPR001478	451	533	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001841	50	87	SM00184	Zinc finger
	IPR001478	289	371	SM00228	PDZ/DHR/GLGF
	IPR001478	461	536	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001841	50	85	PS50089	Zinc finger
	IPR001293	133	171	PS50145	Zinc finger
	IPR001478	281	371	PS50106	PDZ/DHR/GLGF
	IPR001478	451	520	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR001841	65	74	PS00518	Zinc finger

Primer_f	GCGCGAGTTCATGATGCAGAG
Primer_r	TTGTATACTCTAGTGCCGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-