KIAA1097

Product ID	ORK01146
Accession No	AB029020
Description	ubiquitin specific peptidase 33, transcript variant 2
Clone name	hk07058
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4271 bp) Predicted protein sequence (980 aa)
HaloTag ORF Clone	FHC01146
Flexi ORF Clone	FXC01146
Source	Human adult brain
Rouge ID	mKIAA1097 by Kazusa Mouse cDNA Project

Length: 4271 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1326 bp
Genome contig ID	gi89161185r_77834264
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAAAATTAGCTCAATAAAAATGTCTTTAAAATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTTGAATGTTGAATTTATTTGATAGATGTTAAAGGTAAAAGGTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	77934264	77998073	24	99.9	Perfect prediction

Length: 980 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_513509	98.3	ubiquitin speci...	Pan troglodytes
AAL78314	99.8	pVHL-interactin...	Homo sapiens
Q8TEY7	99.7	Ubiquitin carbo...	Homo sapiens
EAX06371	99.4	ubiquitin speci...	Homo sapiens
AAL78315	100.0	pVHL-interactin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023220	7.3e-156	60.0	KIAA1003
D29956	9.3e-16	32.7	KIAA0055
AB011101	4.9e-14	23.9	KIAA0529
AB020698	4.1e-08	22.6	KIAA0891
AB028986	2e-07	30.4	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001607	99	173	PF02148	Zinc finger
HMMPfam	IPR001394	220	750	PF00443	Peptidase C19
HMMSmart	IPR001607	98	150	SM00290	Zinc finger
	IPR006615	770	853	SM00695	Ubiquitin carboxyl-terminal hydrolase
	IPR006615	878	962	SM00695	Ubiquitin carboxyl-terminal hydrolase
ProfileScan	IPR001607	97	161	PS50271	Zinc finger
ProfileScan	IPR001394	223	754	PS50235	Peptidase C19
ScanRegExp	IPR001394	224	239	PS00972	Peptidase C19
ScanRegExp	IPR001394	695	712	PS00973	Peptidase C19

Primer_f	TGTTGATAAAGCTGAGGCCAC
Primer_r	AACATTGCTTTAGCTGGTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGTTGATAAAGCTGAGGCCAC
Primer_r	AACATTGCTTTAGCTGGTGAC
PCR product length	223 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles