HUGE

Gene/Protein Characteristic Table for KIAA0896

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01677
Accession No. :	AB020703
Description :	E3 ubiquitin-protein ligase EDD1.
HUGO Gene Name :	ubiquitin protein ligase E3 component n-recognin 5 (UBR5)
Clone Name :	hk08890s2 [Vector Info]
Flexi ORF Clone :	pF1KA0896
Source :	Human adult brain
Note :	We replaced hk08890 and hk08890s1, former representative clones for KIAA0896 with hk08890s2. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 9250 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 398 bp

Genome contig ID gi51511724r_103235308
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GGAATAGGGAATTTCAAAATAAAAAATTAAGTATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTCTGTGTTTTCATTTTAACTTTTTTTATGGTGTTTAATTTGTGGTTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 103335308 103494093 59 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10396	100.0	E3 ubiquitin-pr...	synthetic construct
EAW91843	99.9	E3 ubiquitin pr...	Homo sapiens
O95071	100.0	E3 ubiquitin-pr...	Homo sapiens
EAW91846	99.9	E3 ubiquitin pr...	Homo sapiens
XP_001100326	99.8	similar to E3 u...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037741	1.1e-11	32.0	KIAA1320
AB002310	3.1e-10	28.8	KIAA0312
AB002315	3.2e-10	28.3	KIAA0317
AB007899	1.6e-09	29.4	KIAA0439
AB046845	1.8e-09	28.2	KIAA1625

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003126 1199 1266 PF02207 Zinc finger

IPR002004 2397 2471 PF00658 Polyadenylate-binding protein/Hyperplastic disc protein

IPR000569 2507 2820 PF00632 HECT

HMMSmart IPR013993 1199 1266 SM00396 Zinc finger

IPR002004 2411 2474 SM00517 Polyadenylate-binding protein/Hyperplastic disc protein

IPR000569 2454 2820 SM00119 HECT

ProfileScan IPR003126 1199 1267 PS51157 Zinc finger

IPR000569 2525 2820 PS50237 HECT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003126	1199	1266	PF02207	Zinc finger
IPR002004	2397	2471	PF00658	Polyadenylate-binding protein/Hyperplastic disc protein
IPR000569	2507	2820	PF00632	HECT
HMMSmart	IPR013993	1199	1266	SM00396	Zinc finger
IPR002004	2411	2474	SM00517	Polyadenylate-binding protein/Hyperplastic disc protein
IPR000569	2454	2820	SM00119	HECT
ProfileScan	IPR003126	1199	1267	PS51157	Zinc finger
IPR000569	2525	2820	PS50237	HECT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCCAGCCTATGCCCTCAATC

Primer_r
: TTTAGAGGAATAGAGTGGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	398 bp
Genome contig ID	gi51511724r_103235308
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGAATAGGGAATTTCAAAATAAAAAATTAAGTATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTCTGTGTTTTCATTTTAACTTTTTTTATGGTGTTTAATTTGTGGTTGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	103335308	103494093	59	99.9	Perfect prediction

Primer_f	: TTCCAGCCTATGCCCTCAATC
Primer_r	: TTTAGAGGAATAGAGTGGGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0896

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information