KIAA1479

Product ID	ORK00847
Accession No	AB040912
Description	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D, transcript variant 1
Clone name	fh17949
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5924 bp) Predicted protein sequence (1022 aa)
HaloTag ORF Clone	FHC00847
Flexi ORF Clone	FXC00847
Source	Human fetal brain
Rouge ID	mKIAA1479 by Kazusa Mouse cDNA Project
Note	We replaced fj05577, former representative clones for KIAA1479 with fh17949. (2001/5/29)

Length: 5924 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2437 bp
Genome contig ID	gi51511731f_45163695
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CGCATGTAAAGTCAAAATAAAATATACAAATCATT
Flanking genome sequence (690016 - 690065)	----+--------+--------+--------+--------+----* ATATCCTGCCTCTTGATATTGAAGAGGTTTATAACATGTTATATTTTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	45263695	45853709	18	99.4	Internal No-hit

Length: 1022 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM69453	100.0	semaphorin 6D i...	Homo sapiens
XP_001164625	99.8	semaphorin 6D i...	Pan troglodytes
XP_001112381	99.3	similar to sema...	Macaca mulatta
XP_001502487	97.8	sema domain, tr...	Equus caballus
XP_596649	96.9	similar to sema...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037789	6.5e-82	45.2	KIAA1368
AB058772	1.2e-71	45.3	KIAA1869
AB040878	9.6e-27	35.8	KIAA1445
AB002329	4.5e-26	34.2	KIAA0331
AB051526	1.3e-18	33.7	KIAA1739

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	70	507	PF01403	Semaphorin/CD100 antigen
HMMPfam	IPR002165	525	593	PF01437	Plexin
HMMSmart	IPR001627	68	498	SM00630	Semaphorin/CD100 antigen
HMMSmart	IPR003659	525	593	SM00423	Plexin/semaphorin/integrin
ProfileScan	IPR001627	38	523	PS51004	Semaphorin/CD100 antigen

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	11	TMRVFLLCAYILLLMVSQLRAVS	33	PRIMARY	23
SOSUI2	2	612	VLITCVFAAFVLGAFIAGVAVYC	634	PRIMARY	23

Primer_f	AGTTAATATGCTGCACACCAC
Primer_r	CTGGTCTTCTGCAACATGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-