HUGE

Gene/Protein Characteristic Table for KIAA1679

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07114
Accession No. :	AB051466
Description :	Thrombospondin type-1 domain-containing protein 7B precursor.
HUGO Gene Name :	thrombospondin, type I, domain containing 7B (THSD7B)
Clone Name :	fh22954 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5724 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1112 bp

Genome contig ID gi89161199f_137430536
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGTATTTATAACAAATAAACTGCTCAAGAGACTGC
Flanking genome sequence
(721223 - 721272)
----+----*----+----*----+----*----+----*----+----*
AGTGTTGGCTGTTCTAGATTTATTCACTTCTGAAGTGCCTTGCCCTTGCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 137530536 138151757 26 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1536 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073896	99.9	thrombospondin,...	Homo sapiens
Q9C0I4	99.9	Thrombospondin ...	Homo sapiens
XP_001490296	89.5	similar to Thro...	Equus caballus
XP_222597	85.8	similar to ADAM...	Rattus norvegicus
Q6P4U0	85.8	Thrombospondin ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023177	0	51.0	KIAA0960
AB040878	2.8e-11	27.2	KIAA1445
AB018305	5.1e-09	30.4	KIAA0762
AB011177	3.9e-08	28.9	KIAA0605
AB011122	8.5e-07	25.2	KIAA0550

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000884 111 160 PF00090 Thrombospondin

IPR000884 268 316 PF00090 Thrombospondin

IPR000884 533 588 PF00090 Thrombospondin

IPR000884 669 723 PF00090 Thrombospondin

IPR000884 803 851 PF00090 Thrombospondin

IPR000884 932 983 PF00090 Thrombospondin

IPR000884 1061 1110 PF00090 Thrombospondin

IPR000884 1181 1231 PF00090 Thrombospondin

IPR000884 1304 1360 PF00090 Thrombospondin

HMMSmart IPR000884 110 161 SM00209 Thrombospondin

IPR000884 267 327 SM00209 Thrombospondin

IPR000884 415 471 SM00209 Thrombospondin

IPR000884 532 589 SM00209 Thrombospondin

IPR000884 592 663 SM00209 Thrombospondin

IPR000884 668 724 SM00209 Thrombospondin

IPR000884 802 850 SM00209 Thrombospondin

IPR000884 856 926 SM00209 Thrombospondin

IPR000884 931 988 SM00209 Thrombospondin

IPR000884 991 1055 SM00209 Thrombospondin

IPR000884 1060 1111 SM00209 Thrombospondin

IPR000884 1114 1175 SM00209 Thrombospondin

IPR000884 1180 1232 SM00209 Thrombospondin

IPR000884 1233 1298 SM00209 Thrombospondin

IPR000884 1303 1361 SM00209 Thrombospondin

ProfileScan IPR000884 107 161 PS50092 Thrombospondin

IPR000884 264 320 PS50092 Thrombospondin

IPR000884 327 410 PS50092 Thrombospondin

IPR000884 412 471 PS50092 Thrombospondin

IPR000884 529 589 PS50092 Thrombospondin

IPR000884 590 663 PS50092 Thrombospondin

IPR000884 665 724 PS50092 Thrombospondin

IPR000884 799 852 PS50092 Thrombospondin

IPR000884 928 1055 PS50092 Thrombospondin

IPR000884 1057 1111 PS50092 Thrombospondin

IPR000884 1177 1232 PS50092 Thrombospondin

IPR000884 1300 1361 PS50092 Thrombospondin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000884	111	160	PF00090	Thrombospondin
IPR000884	268	316	PF00090	Thrombospondin
IPR000884	533	588	PF00090	Thrombospondin
IPR000884	669	723	PF00090	Thrombospondin
IPR000884	803	851	PF00090	Thrombospondin
IPR000884	932	983	PF00090	Thrombospondin
IPR000884	1061	1110	PF00090	Thrombospondin
IPR000884	1181	1231	PF00090	Thrombospondin
IPR000884	1304	1360	PF00090	Thrombospondin
HMMSmart	IPR000884	110	161	SM00209	Thrombospondin
IPR000884	267	327	SM00209	Thrombospondin
IPR000884	415	471	SM00209	Thrombospondin
IPR000884	532	589	SM00209	Thrombospondin
IPR000884	592	663	SM00209	Thrombospondin
IPR000884	668	724	SM00209	Thrombospondin
IPR000884	802	850	SM00209	Thrombospondin
IPR000884	856	926	SM00209	Thrombospondin
IPR000884	931	988	SM00209	Thrombospondin
IPR000884	991	1055	SM00209	Thrombospondin
IPR000884	1060	1111	SM00209	Thrombospondin
IPR000884	1114	1175	SM00209	Thrombospondin
IPR000884	1180	1232	SM00209	Thrombospondin
IPR000884	1233	1298	SM00209	Thrombospondin
IPR000884	1303	1361	SM00209	Thrombospondin
ProfileScan	IPR000884	107	161	PS50092	Thrombospondin
IPR000884	264	320	PS50092	Thrombospondin
IPR000884	327	410	PS50092	Thrombospondin
IPR000884	412	471	PS50092	Thrombospondin
IPR000884	529	589	PS50092	Thrombospondin
IPR000884	590	663	PS50092	Thrombospondin
IPR000884	665	724	PS50092	Thrombospondin
IPR000884	799	852	PS50092	Thrombospondin
IPR000884	928	1055	PS50092	Thrombospondin
IPR000884	1057	1111	PS50092	Thrombospondin
IPR000884	1177	1232	PS50092	Thrombospondin
IPR000884	1300	1361	PS50092	Thrombospondin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1486 IWVYGVSGGAFLIMIFLIFTSYL 1508 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1486	IWVYGVSGGAFLIMIFLIFTSYL	1508	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CATGCCAGCTGAGTGAAAACG

Primer_r
: GAGAGCTGACAGTTGACCACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: CCR
Primer_f	: CATGCCAGCTGAGTGAAAACG
Primer_r	: GAGAGCTGACAGTTGACCACG
PCR product length	: 178(2.0k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1112 bp
Genome contig ID	gi89161199f_137430536
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTATTTATAACAAATAAACTGCTCAAGAGACTGC
Flanking genome sequence (721223 - 721272)	----+--------+--------+--------+--------+----* AGTGTTGGCTGTTCTAGATTTATTCACTTCTGAAGTGCCTTGCCCTTGCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	137530536	138151757	26	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1679

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information